[1] 10w Brainstem encephalitis: an unusual presentation of herpes simplex virus infection

[1] 194w Herpes simplex virus (HSV) encephalitis has a predilection for the temporal and frontal lobes but occasionally affects the brainstem. We describe a patient who developed HSV brainstem encephalitis that progressed to quadriplegia. Using MEDLINE, we conducted a comprehensive review of other published cases of HSV brainstem encephalitis. Twenty-four published cases of HSV brainstem encephalitis met our inclusion criteria. The mean age was 41.4 years (range 18-71). HSV-1 was the etiologic agent in 79% of reported HSV brainstem encephalitis cases, and HSV-2 accounted for 21% of cases. Infection was limited to the brainstem in 29% of cases and multi-focal, including the brainstem, in 71%. Common manifestations of HSV brainstem encephalitis included neuro-ophthalmologic findings (81%), cranial nerve deficits (69%), and fever (69%). Quadriplegia, as occurred in our patient, was an unusual finding (19%). The mortality rate of HSV brainstem encephalitis was 41%. Intravenous acyclovir showed a beneficial effect on mortality (75% vs. 22%, p = 0.06). HSV brainstem encephalitis is a distinct type of HSV encephalitis. With the increasing use of HSV-PCR, more cases of HSV brainstem encephalitis may be identified. A greater recognition of this syndrome will help better define its optimal treatment and prognosis.

[1] 67w Herpes simplex virus (HSV) encephalitis is considered the most common sporadic, non-seasonal encephalitis. HSV encephalitis occurs in as many as 2.2 in a million people per year [1]. If untreated, 70% of patients with HSV encephalitis die [2]. HSV generally has a predilection for the frontal or temporal lobes, which is demonstrated by radiologic reviews [3]. In rare cases, the virus has been restricted to the brainstem.

[2] 88w We describe a case of HSV brainstem encephalitis in a patient that presented with what was thought to be a typical cerebral ischemic event, but whose neurologic deficits progressed to quadriplegia. Magnetic resonance imaging (MRI) was significant for abnormal signal intensities within the anterior brainstem. Polymerase chain reaction (PCR) of the cerebrospinal fluid (CSF) was positive for HSV, and serum serologies revealed previous exposure to HSV-1. We also review reported cases in the medical literature of HSV brainstem encephalitis and summarize the syndrome's clinical presentation and clinical outcomes.

[3] 38w A 58-year-old African American woman presented to the hospital with a 2-day history of right-sided weakness, slurred speech, and headache. She denied any recent febrile episodes. The patient had a previous medical history of hypertension and tobacco use.

[4] 99w Her initial evaluation demonstrated a blood pressure of 162/103 mmHg, heart rate of 63 beats/minute, respirations 18 breaths/min, and temperature 36°C. Initial physical exam was remarkable for slurred speech and mild rightsided weakness. She exhibited 4/5 strength in her right upper and lower extremities. All sensory modalities were intact. Her gait was paretic. She had no rash and no oral lesions. Complete blood count and comprehensive metabolic panels were all within normal limits. Electrocardiogram showed normal sinus rhythm. A head computed tomography scan showed no evidence of an acute stroke. The patient was admitted for a suspected cerebrovascular accident.

[5] 34w On her third day of admission, MRI of the brain showed FLAIR and T2 hyperintensity throughout the medulla and upper cervical cord; it also showed an area in the medulla compatible with acute ischemia.

[6] 68w On her fifth day of admission, the patient reported worsening right-sided weakness and also left-sided weakness. Within the next 24 h, she developed 0/5 strength in all four extremities and required intubation. Repeat neurologic exam revealed a few beats of clonus at her ankles and generalized hyperreflexia. Pupils and ocular movements were normal. Her gag reflex and corneal reflexes were intact. She was able to protrude her tongue.

[7] 67w On her seventh hospital day, a repeat MRI showed persistent FLAIR-T2 signal abnormality in the medulla and upper cervical cord (Fig. 1). A lumbar puncture was also performed, but the opening pressure was not measured. The cerebrospinal fluid (CSF) demonstrated 52 white blood cells/mm 3 (26% neutrophils, 53% lymphocytes, and 12% monocytes), 13,400 red blood cells/mm 3 , 198 mg/dL of protein, and 68 mg/dL of glucose.

[8] 133w Fig. 1 Increased FLAIR and T2 signal was seen diffusely throughout the medulla (top row) and upper cervical cord (not shown) consistent with inflammation or edema. DWI (bottom left) demonstrated restricted diffusion in the paramedian medulla. There was also corresponding decreased signal in ADC (bottom right) consistent with acute ischemia. The rest of the T1, hemosiderin series, and MRA were negative Empiric antimicrobials were started, which included ampicillin, ceftriaxone, acyclovir, and dexamethasone. CSF cultures revealed no growth, and CSF cytology was negative for malignant cells. Serum RPR, CSF VDRL, and HIV EIA were negative. Serologies for histoplasmosis and coccidioidomycosis were negative. Mycoplasma serologies revealed evidence of remote infection. PCRs on her CSF for EBV, CMV and VZV were also negative. Her erythrocyte sedimentation rate was 42 mm/h, and C-reactive protein was 0.43 mg/dL.

[9] 159w Using an in-house real-time PCR, the medical team identified HSV-DNA in the patient's CSF by amplifying and detecting the conserved sequence of the pol gene within the HSV genome [4]. This assay did not differentiate between HSV-1 and HSV-2. DNA from the CSF was extracted with Qiagen DNA Extraction (Qiagen Inc., Valencia, CA), and the LightCycler DNA Faststart Hybridization Probes Master Mix Kit was used (Roche Diagnostics, Indianapolis, IN). The primer pair was 5 0 CATCCAGGACTTTGTCCTCACC 3 0 and 5 0 CGGGCCATGAGCTTGTAATAC 3 0 , and the probe was 5 0 CGCGCGCGTACACCAACAAGC. The probe, labeled with TAMRA quencher dye at the 3 0 end and with FAM reporter dye at the 5 0 end, detected the 100 base-paired amplification products. The PCR assay was performed on LightCycler with 50 cycles at 95°C for 2 s and at 64°C for 20 s. A crossing point by cycle of threshold (Ct) at 10 or over was considered positive for HSV DNA.

[10] 77w Based on the positive HSV-PCR results, all antimicrobials except acyclovir were stopped. The patient received a 21-day course of intravenous acyclovir at a dose of 10 mg/ kg every 8 h. Dexamethasone was tapered over a 2-week course. On day 20 of acyclovir, her lumbar puncture was repeated, and the HSV-PCR of her CSF was negative. The patient's serum herpes antibody profile, obtained on hospital day 21, demonstrated a positive HSV-1 IgG and a negative HSV-2 IgG.

[11] 33w After 79 days of hospitalization, the patient was discharged to a long-term care facility. She showed some signs of improvement but remained quadriplegic. She was breathing on her own through a tracheostomy collar.

[1] 79w The MEDLINE search retrieved 175 citations. All abstracts were reviewed, and 22 articles were found to be potentially eligible. An additional five articles were identified by perusing reference lists of the retrieved articles. These 27 publications included 33 adult cases of herpes simplex brainstem encephalitis . After reading each article in full, we excluded nine of the cases because they lacked pathologic or radiologic evidence of brainstem involvement, thereby leaving only 24 cases to include in this review [5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20][21][22][23].

[2] 70w The mean age of these 24 patients was 41.4 years (range 18-71). Thirteen (54%) were male and eleven (46%) were female. Nineteen cases specified the HSV strain, which was HSV-1 in 15 cases (79%) and HSV-2 in four cases (21%). Immune-compromising conditions were only described in five cases, which included AIDS in three cases, bone marrow transplant in one case, and immunosuppressant drug use for rheumatoid arthritis in one case.

[3] 108w Encephalitis was limited to the brainstem (midbrain, pons, and/or medulla) in seven cases (29%). In the remaining 17 cases (71%), both the brainstem and other areas of the brain were affected. Other common sites of involvement included the temporal lobe in 10 (42%) cases, the frontal lobe in eight (33%) cases, and the cerebellum in six (25%) cases. Less common sites of involvement included the basal ganglia in two (8%) cases and the cervical spinal cord in one (4%) case. Confirmation of HSV infection was made by CSF-PCR in seven cases (29%), autopsy in 13 cases (54%) and demonstration of intrathecal HSV antibody synthesis in four cases (17%).

[4] 95w Clinical characteristics were described in 16 patients (Table 1). The most common clinical finding was neuroophthalmologic abnormalities, which were present in 13 cases (81%). Neuro-ophthalmologic abnormalities included nystagmus, impaired ocular movements, anisocoria, ptosis, oscillopsia, or spasmodic movements. Other cranial nerve deficits (excluding CN III, IV, VI) were described in 11 (69%) cases, fever in 11 (69%), headache in eight (50%), altered mentation in eight (50%), corticospinal tract findings (e.g. motor weakness, hyperreflexia, extensor plantar response) in seven (44%), ataxia in six (38%), and dysphagia in five (31%). Quadriplegia was only present in three patients (19%).

[5] 46w CSF cell counts and chemistries were described in ten patients. The mean CSF white blood cell count was 93 cells (range 0-465), which was neutrophilic-predominant in four, monocytic-predominant in three, lymphocytic-predominant in two, and not reported in one. The mean protein was 126.8 mg/dL (range 27-300).

[6] 101w Treatment course was described in 17 of 24 cases. Of these 17 cases, nine (53%) received intravenous acyclovir, one (6%) received vidarabine, one (6%) received adenosine arabinoside, and six (35%) received no treatment. Three patients (18%) also received steroids of varying doses and durations. Outcome was described in 22 of the 24 cases: nine patients (41%) died. Six of the patients who died did not receive acyclovir. The mortality rate for patients who received acyclovir was 22% (2/9) compared to 75% (6/8) in patients not treated with acyclovir (p = 0.06). Seven of the 13 (54%) surviving had chronic neurological impairments.

[1] 207w Brainstem disease in HSV encephalitis can range from isolated brainstem involvement to multifocal brain involvement that also affects the brainstem. In the literature, the term ''HSV brainstem encephalitis'' has been used to describe both clinical scenarios. From a pathogenesis perspective, why HSV involves the brainstem in only select cases has not been elucidated. Given that HSV is thought to gain entry to the brain via the trigeminal nerve, brainstem involvement may potentially be more frequent than identified clinically or reported in the literature. Our patient was an otherwise immunocompetent individual with an abrupt onset of right-sided weakness that later progressed to quadriplegia. The isolation of HSV-DNA from her cerebrospinal fluid was highly consistent with herpes simplex replication within the central nervous system and, in light of her clinical presentation, diagnostic of HSV encephalitis. Based on the MRI findings of brainstem edema, her syndrome can be categorized as brainstem encephalitis. Her HSV serologies were consistent with prior exposure to HSV-1, which we assumed was the etiologic agent of her disease. In the absence of followup serologies, however, we cannot exclude that her clinical presentation represented an acute HSV-2 infection. Use of a modern real-time PCR able to distinguish between the two types of HSV would have been helpful.

[2] 60w The predominance of HSV-1 disease is seen in both brainstem and classic HSV encephalitis [31,32]. Unlike classic HSV encephalitis [3,33], neuro-ophthalmologic abnormalities and cranial nerve deficits were the most commonly reported findings in cases of brainstem disease. This likely reflects direct viral invasion of the brainstem. Interestingly, fever-which is almost universal in typical HSV-encephalitis-only occurred in 69% of brainstem cases.

[3] 95w The early detection of HSV as the etiology of encephalitis is essential. Other etiologies should also be considered, which include Listeria monocytogenes, Mycoplasma pneumoniae, cytomegalovirus, rabies virus, and Toxoplasma gondii [34]. Historically, brain biopsy was used for confirmation of HSV, but in cases of brainstem encephalitis, biopsy would be inappropriate. Based on studies of classic HSV encephalitis, the quickest and most reliable method of testing for HSV is CSF PCR, which has a reported sensitivity of 98% and a specificity of 94-100% [35,36]. The diagnostic utility of CSF PCR for HSV brainstem encephalitis is undefined.

[4] 91w For classic HSV encephalitis, acyclovir at a dose of 30 mg/kg intravenous per day has been shown to decrease morbidity and mortality [37,38]. Presumably, acyclovir should also be effective for brainstem HSV encephalitis. In fact, our review of published HSV brainstem cases revealed a trend toward lower mortality with intravenous acyclovir use. Beginning acyclovir earlier correlates with better outcomes for classic HSV encephalitis [39], and treatment is generally continued for 14-21 days. Even with acyclovir treatment, 1-year mortality from classic HSV encephalitis is 14% and long-term neurological dysfunction is common [1,33].

[5] 41w Based on our findings, the mortality rate for HSV brainstem encephalitis is higher than classic disease. Since the brainstem controls many vital functions, it is plausible that HSV brainstem involvement carries a worse prognosis compared to temporal and frontal lobe involvement.

[6] 48w The use of steroids has been suggested as a possible adjunctive therapy to acyclovir in HSV encephalitis. In an animal model, steroids were of benefit in reducing MRI abnormalities [40]. In a retrospective study of patients with classic HSV encephalitis, corticosteroid use was associated with improved outcomes [41].

[7] 72w Since our patient received acyclovir and dexamethasone concomitantly, it is not clear which agent halted progression of her neurologic deficits. In all likelihood, earlier initiation of these medications would have improved her ultimate neurologic outcome. Unfortunately, her absence of fever delayed the consideration of an infectious etiology. HSV encephalitis should be on the differential diagnosis for all patients presenting with apparent strokes, especially those who do not follow a typical clinical course.

[8] 50w Our study represents the largest review of HSV brainstem encephalitis cases published to date. We have tried to summarize the common manifestations of this syndrome as well as its therapeutic outcomes. Unfortunately, the case reports were heterogeneous in quality. The small sample size precluded us from reaching any statistical conclusions.

[9] 76w Based on our review, isolated brainstem involvementas in our patient-occurs less frequently than concomitant involvement of the brainstem and other sites. Neuro-ophthalmologic abnormalities are the most common finding in HSV brainstem encephalitis, but our patient's development of quadriplegia is unusual. With the increasing use of HSV-PCR in clinical practice, we expect more cases of HSV brainstem encephalitis to be diagnosed. A greater recognition of this syndrome may help to define its optimal treatment and overall prognosis.

[1] 103w A MEDLINE search of the literature from 1970 to December 2009 was done to find all English-language reports of herpes simplex brainstem encephalitis. The search term was ''herpes simplex brainstem encephalitis''. Additional cases were included by review of the references of the reports found in the MEDLINE search. Inclusion criteria included (1) age C18 years of age, (2) pathologic or radiologic evidence of brainstem involvement, and (3) confirmation of HSV by polymerase chain reaction, pathologic staining, or demonstration of intrathecal HSV antibody synthesis. Cases were excluded if more than one infectious etiology was identified. Statistical analysis was performed using the Fisher's exact test.